TTTY13 siRNA/shRNA/RNAi Lentivector (Human) (Target b) - i026375b

Artikelnummer: ABM-487450910595
Artikelname: TTTY13 siRNA/shRNA/RNAi Lentivector (Human) (Target b) - i026375b
Artikelnummer: ABM-487450910595
Hersteller Artikelnummer: 487450910595
Alternativnummer: ABM-487450910595
Hersteller: Applied Biological Materials
Kategorie: Molekularbiologie
Spezies Reaktivität: Human
Quelle: Puromycin
Sequenz: TACGTCCAAGGTCGGGCAGGAAGA
Target-Kategorie: Sequence available upon placing order