TRAV8-1-set siRNA/shRNA/RNAi Lentivector (Human) - i025252

Catalog Number: ABM-475810910395
Article Name: TRAV8-1-set siRNA/shRNA/RNAi Lentivector (Human) - i025252
Biozol Catalog Number: ABM-475810910395
Supplier Catalog Number: 475810910395
Alternative Catalog Number: ABM-475810910395
Manufacturer: Applied Biological Materials
Category: Molekularbiologie
Species Reactivity: Human
Source: Puromycin
Sequence: TACGTCCAAGGTCGGGCAGGAAGA
Target: Sequence available upon placing order