TTTY13-set siRNA/shRNA/RNAi Lentivector (Human) - i026375

Catalog Number: ABM-487450910395
Article Name: TTTY13-set siRNA/shRNA/RNAi Lentivector (Human) - i026375
Biozol Catalog Number: ABM-487450910395
Supplier Catalog Number: 487450910395
Alternative Catalog Number: ABM-487450910395
Manufacturer: Applied Biological Materials
Category: Molekularbiologie
Species Reactivity: Human
Source: Puromycin
Sequence: TACGTCCAAGGTCGGGCAGGAAGA
Target: Sequence available upon placing order