TTTY13 siRNA/shRNA/RNAi Lentivector (Human) (Target a) - i026375a

Catalog Number: ABM-487450910495
Article Name: TTTY13 siRNA/shRNA/RNAi Lentivector (Human) (Target a) - i026375a
Biozol Catalog Number: ABM-487450910495
Supplier Catalog Number: 487450910495
Alternative Catalog Number: ABM-487450910495
Manufacturer: Applied Biological Materials
Category: Molekularbiologie
Species Reactivity: Human
Source: Puromycin
Sequence: TACGTCCAAGGTCGGGCAGGAAGA
Target: Sequence available upon placing order