ASCT2/SLC1A5 Rabbit mAb, Unconjugated

Produktübersicht

• Artikelname: ASCT2/SLC1A5 Rabbit mAb, Unconjugated
• Artikelnummer: ABB-A23156
• Hersteller Artikelnummer: A23156
• Alternativnummer: ABB-A23156-500UL,ABB-A23156-1000UL,ABB-A23156-100UL,ABB-A23156-20UL
• Hersteller: ABclonal
• Wirt: Rabbit
• Kategorie: Antikörper
• Applikation: ELISA, IHC-P, WB
• Spezies Reaktivität: Human
• Immunogen: Recombinant protein (or fragment).This information is considered to be commercially sensitive.
• Konjugation: Unconjugated
• Alternative Synonym: R16, AAAT, ATBO, M7V1, RDRC, ASCT2, M7VS1, ASCT2/SLC1A5

Produktbeschreibung

The SLC1A5 gene encodes a sodium-dependent neutral amino acid transporter that can act as a receptor for RD114/type D retrovirus (Larriba et al., 2001 [PubMed 11781704]).

Produkteigenschaften

• Klonalität: Monoclonal
• Klon-Bezeichnung: [ARC59409]
• Molekulargewicht: 57kDa
• NCBI: 6510
• UniProt: Q15758
• Reinheit: Affinity purification
• Sequenz: CAAAATTACGTGGACCGTACGGAGTCGAGAAGCACAGAGCCTGAGTTGATACAAGTGAAGAGTGAGCTGCCCCTGGATCCGCTGCCAGTCCCCACTGAGGAAGGAAACCCCCTCCTCAAACACTATCGGGGGCCCGCAGGGGATGCCACGGTCGCCTCTGAGAAGGAATCAGTCATG
• Target-Kategorie: SLC1A5
• Antibody Type: Primary Antibody

Anwendungsbeschreibung

• Application Verdünnung: WB,1:1000 - 1:2000|IHC-P,1:1000 - 1:4000|ELISA,Recommended starting concentration is 1 µg/mL. Please optimize the concentration based on your specific assay requirements.
• Anwendungsbeschreibung: Cross-Reactivity: Human, ResearchArea: Molecular functioni amino acid transmembrane transporter,Reactome L-glutamine transmembrane,Reactome L-glutamine transmembrane transporter.

Bilder

Western blot analysis of lysates from 293F cells, using ASCT2/SLC1A5 Rabbit mAb (A23156) at 1:1000 dilution.
Secondary antibody: HRP-conjugated Goat anti-Rabbit IgG (H+L) (AS014) at 1:10000 dilution.
Lysates/proteins: 25µg per lane.
Blocking buffer: 3% nonfat dry milk in TBST.
Detection: ECL Basic Kit (RM00020).
Exposure time: 60s.

Immunohistochemistry analysis of paraffin-embedded Human cervix tissue using ASCT2/SLC1A5 Rabbit mAb (A23156) at a dilution of 1:2000 (40x lens). High pressure antigen retrieval performed with 0.01M Tris-EDTA Buffer (pH 9.0) prior to IHC staining.

Western blot analysis of lysates from Jurkat cells, using ASCT2/SLC1A5 Rabbit mAb (A23156) at 1:1000 dilution.
Secondary antibody: HRP-conjugated Goat anti-Rabbit IgG (H+L) (AS014) at 1:10000 dilution.
Lysates/proteins: 25µg per lane.
Blocking buffer: 3% nonfat dry milk in TBST.
Detection: ECL Basic Kit (RM00020).
Exposure time: 60s.

Immunohistochemistry analysis of paraffin-embedded Human colon carcinoma tissue using ASCT2/SLC1A5 Rabbit mAb (A23156) at a dilution of 1:2000 (40x lens). High pressure antigen retrieval performed with 0.01M Tris-EDTA Buffer (pH 9.0) prior to IHC staining.

Immunohistochemistry analysis of paraffin-embedded Human colon tissue using ASCT2/SLC1A5 Rabbit mAb (A23156) at a dilution of 1:2000 (40x lens). High pressure antigen retrieval performed with 0.01M Tris-EDTA Buffer (pH 9.0) prior to IHC staining.

Immunohistochemistry analysis of paraffin-embedded Human kidney tissue using ASCT2/SLC1A5 Rabbit mAb (A23156) at a dilution of 1:2000 (40x lens). High pressure antigen retrieval performed with 0.01M Tris-EDTA Buffer (pH 9.0) prior to IHC staining.

Immunohistochemistry analysis of paraffin-embedded Human lung cancer tissue using ASCT2/SLC1A5 Rabbit mAb (A23156) at a dilution of 1:2000 (40x lens). High pressure antigen retrieval performed with 0.01M Tris-EDTA Buffer (pH 9.0) prior to IHC staining.

Immunohistochemistry analysis of paraffin-embedded Human placenta tissue using ASCT2/SLC1A5 Rabbit mAb (A23156) at a dilution of 1:2000 (40x lens). High pressure antigen retrieval performed with 0.01M Tris-EDTA Buffer (pH 9.0) prior to IHC staining.

Immunohistochemistry analysis of paraffin-embedded Human thyroid cancer tissue using ASCT2/SLC1A5 Rabbit mAb (A23156) at a dilution of 1:2000 (40x lens). High pressure antigen retrieval performed with 0.01M Tris-EDTA Buffer (pH 9.0) prior to IHC staining.