LexA | LexA repressor (protein, positive control)

Artikelnummer: AGR-AS21-4541P
Artikelname: LexA | LexA repressor (protein, positive control)
Artikelnummer: AGR-AS21-4541P
Hersteller Artikelnummer: AS21-4541P
Alternativnummer: AGR-AS21-4541P
Hersteller: Agrisera
Kategorie: Proteine/Peptide
Applikation: WB
Escherichia coli LexA protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexAs self-protease activity is
Molekulargewicht: 22.3 | 23 kDa
UniProt: P0A7C2
Reinheit: Contains 50% glycerol, 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT. Over 90% pure by SDS-PAGE.
Formulierung: Liquid
Antibody Type: Secondary Antibody
Anwendungsbeschreibung: LexA protein is full-length, highly purified (over 90%, SDS-PAGE) provided at a concentration of 1 mg/ml estimated by BCA method. UniProt: P0A7C2