CD161 Recombinant Protein, E. coli

Artikelnummer: BWT-NCP0285
Artikelname: CD161 Recombinant Protein, E. coli
Artikelnummer: BWT-NCP0285
Hersteller Artikelnummer: NCP0285
Alternativnummer: BWT-NCP0285-500UG,BWT-NCP0285-1MG
Hersteller: Bioworld Technology
Wirt: E. coli
Kategorie: Proteine/Peptide
CD161/KLRB1 (Killer cell lectin-like receptor subfamily B member 1, also known as CLEC5B and NKR-P1A) is a type II transmembrane protein that is expressed on the majority of Natural Killer (NK) cells, NK T cells, and some T lymphocytes. CD161/KLRB1 is also expressed on Th17 cells, promotes their generation, and modulates their function. Engagement with its ligand lectin-like transcript 1 (LLT1) inhibits NK cell function, while LLT1 and CD161/KLRB1 interaction in the presence of a TCR signal enhances IFN-gamma production by T cells. There are several different CD161 isoforms in rodents and some function as activating receptors as well.
Molekulargewicht: ~22kDa
Tag: His-tag
UniProt: Q12918
Puffer: PBS, 4M Urea, PH7.4
Expression System: pet-22b(+)
Reinheit: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Sequenz: CAGAAAAGCAGTATTGAAAAGTGTAGCGTTGATATTCAGCAGAGTCGCAATAAAACCACCGAACGTCCGGGCCTGCTGAATTGCCCGATCTATTGGCAGCAGCTGCGTGAAAAATGCCTGCTGTTCAGCCATACCGTTAATCCGTGGAATAATAGTCTGGCCGATTGCAGTACCAAAGAAAGTAGTCTGCTGCTGATTCGTGATAAAGATGAACTGATTCATACCCAGAATCTGATTCGTGACAAAGCCATTCTG