CD172g Recombinant Protein, E. coli

Artikelnummer: BWT-NCP0295
Artikelname: CD172g Recombinant Protein, E. coli
Artikelnummer: BWT-NCP0295
Hersteller Artikelnummer: NCP0295
Alternativnummer: BWT-NCP0295-500UG,BWT-NCP0295-1MG
Hersteller: Bioworld Technology
Wirt: E. coli
Kategorie: Proteine/Peptide
SIRPs (signal-regulatory proteins) are a family of transmembrane glycoproteins that were identified by their association with the Src homology 2 domaincontaining protein-tyrosine phosphatase SHP-2 in response to Insulin. The SIRP family negatively regulates the PI 3-K pathway, which may diminish EGFR-mediated motility and survival phenotypes that contribute to transformation of certain cell types. SIRP-alpha1 is a transmembrane protein which contains an extracellular portion with three immunoglobulin-like structures and a cytoplasmic region with four potential tyrosine phosphorylation sites. SIRP-alpha1 is a substrate for activated receptor tyrosine kinases. In its tyrosine phosphorylated form, SIRP-alpha1 binds to SH-PTP2 through SH2 interactions and acts as an SH-PTP2 substrate. SIRP-alpha1 has been shown to have negative regulatory effects on cellular responses induced by growth factors, oncogenes and insulin. SIRP-beta1 shares extensive sequence homology with SIRP-alpha1 in its extracellular portion but lacks the cytoplasmic portion. SIRP-gamma, originally designated SIRP-beta2 (SIRP-B2, CD172g) has unique characteristics from both the alpha and beta versions. SIRP-gamma is expressed on the majority of T cells and a proportion of B cells. CD47 associates with SIRP-gamma, and this interaction signals unidirectionally only.
Molekulargewicht: ~37kDa
Tag: His-tag
UniProt: Q9P1W8
Puffer: PBS, 4M Urea, PH7.4
Expression System: pet-22b(+)
Reinheit: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Sequenz: GAAGAAGAACTGCAGATGATTCAGCCGGAAAAACTGCTGCTGGTGACCGTGGGCAAAACCGCCACCCTGCATTGCACCGTGACCAGCCTGCTGCCGGTTGGCCCGGTGCTGTGGTTCCGCGGTGTTGGTCCGGGCCGCGAACTGATCTATAATCAGAAAGAAGGCCACTTCCCGCGTGTTACCACCGTGAGCGATCTGACCAAACGCAATAATATGGACTTCAGCATTCGCATTAGCAGCATTACCCCGGCAGAT