ACYP1 cDNA

Artikelnummer: USB-551820
Artikelname: ACYP1 cDNA
Artikelnummer: USB-551820
Hersteller Artikelnummer: 551820
Alternativnummer: USB-551820-10
Hersteller: US Biological
Kategorie: Molekularbiologie
ACYP1 is a member of the acylphosphatase family. The encoded protein is a small cytosolic enzyme that catalyzes the hydrolysis of the carboxyl-phosphate bond of acylphosphates. Two isoenzymes have been isolated and described based on their tissue localization: erythrocyte (common) type acylphosphatase encoded by this gene, and muscle type acylphosphatase. Alternative splicing results in multiple transcript variants. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 300bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCAGAAGGAAACACCCTGATATCAGTGGATTATGAAATTTTTGGGAAGGTGCAAGGGGTGTTTTTCCGTAAGCATACTCAGGCTGAGGGTAAAAAGCTGGGATTGGTAGGCTGGGTCCAGAACACTGACCGGGGCACAGTGCAAGGACAATTGCAAGGTCCCATCTCCAAGGTGCGTCATATGCAGGAATGGCTTGAAACAAGAGGAAGTCCTAAATCACACATCGACAAAGCAAACTTCAACAATGAAAAAGTCATCTTGAAGTTGGATTACTCAGACTTCCAAATTGTAAAATAA Translation Sequence: MAEGNTLISV DYEIFGKVQG VFFRKHTQAE GKKLGLVGWV QNTDRGTVQG QLQGPISKVRHMQEWLETRG SPKSHIDKAN FNNEKVILKL DYSDFQIVK Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 001098
Formulierung: Supplied as a lyophilized powder.