AK4 cDNA

Artikelnummer: USB-551826
Artikelname: AK4 cDNA
Artikelnummer: USB-551826
Hersteller Artikelnummer: 551826
Alternativnummer: USB-551826-10
Hersteller: US Biological
Kategorie: Molekularbiologie
AK4 encodes a member of the adenylate kinase family of enzymes. The encoded protein is localized to the mitochondrial matrix. Adenylate kinases regulate the adenine and guanine nucleotide compositions within a cell by catalyzing the reversible transfer of phosphate group among these nucleotides. Five isozymes of adenylate kinase have been identified in vertebrates. Expression of these isozymes is tissue-specific and developmentally regulated. A pseudogene for this gene has been located on chromosome 17. Three transcript variants encoding the same protein have been identified for this gene. Sequence alignment suggests that the gene defined by NM_013410, NM_203464, and NM_001005353 is located on chromosome 1. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 831bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCAGCCGAGACTCGGAACGTGGCCGGAGCAGAGGCCCCACCGCCCCAGAAGCGCTACTACCGGCAACGTGCTCACTCCAACCCCATGGCGGACCACACGCTGCGCTACCCTGTGAAGCCAGAGGAGATGGACTGGTCTGAGCTATACCCAGAGTTCTTCGCTCCACTCACTCAAAATCAGAGCCACGATGACCCAAAGGATAAGAAAGAAAAGAGAGCTCAGGCCCAAGTGGAGTTTGCAGACATAGGCTGTGGCTATGGTGGCCTGTTAGTGGAACTGTCACCGCTGTTCCCAGACACACTTATTCTGGGTCTGGAGATCCGGGTGAAGGTCTCAGACTATGTACAAGACCGGATTCGGGCCCTACGCGCAGCTCCTGCAGGTGGCTTCCAGAACATCGCCTGTCTCCGTAGCAATGCCATGAAGCACCTTCCTAACTTCTTCTACAAGGGCCAGCTGACAAAGATGTTCTTCCTCTTCCCCGACCCACATTTCAAGCGGACAAAGCACAAGTGGCGAATCATCAGTCCCACCCTGCTAGCAGAATATGCCTACGTGCTAAGAGTTGGGGGGCTGGTGTATACCATAACCGATGTGCTGGAGCTACACGACTGGATGTGCACTCATTTCGAAGAGCACCCACTGTTTGAGCGTGTGCCTCTGGAGGACCTGAGTGAAGACCCCGTTGTGGGACATCTAGGCACCTCAACTGAGGAGGGGAAGAAAGTTCTACGTAATGGAGGGAAGAATTTCCCAGCCATCTTCCGAAGAATACAAGATCCCGTCCTCCAGGCAGTGACCTCCCAAACCAGCCTGCCTGGTCACTGA Translation Sequence: MAAETRNVAG AEAPPPQKRY YRQRAHSNPM ADHTLRYPVK PEEMDWSELY PEFFAPLTQN QSHDDPKDKK EKRAQAQVEF ADIGCGYGGL LVELSPLFPD TLILGLEIRV KVSDYVQDRI RALRAAPAGG FQNIACLRSN AMKHLPNFFY KGQLTKMFFL FPDPHFKRTK HKWRIISPTL LAEYAYVLRV GGLVYTITDV LELHDWMCTH FEEHPLFERV PLEDLSEDPV VGHLGTSTEE GKKVLRNGGK NFPAIFRRIQ DPVLQAVTSQ TSLPGH Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 982289
Formulierung: Supplied as a lyophilized powder.