APRG1 (AP20 region protein 1) is a 170aa single-pass membrane protein that exists as 3 alternatively spliced isoforms. The gene encoding APRG1 maps to human chromosome 3, which houses over 1, 100 genes, including a chemokine receptor (CKR) gene cluster and a variety of human cancer-related gene loci. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 360bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGAAAACAATGGCAACAAGAAAAAGGTGTAAACTTTCCAGAACAGGCCCAGAATTTGAAAATGTGATAAAGAGGTTATTGTGCGCCCGAACTTTTCACACAAGAATTGGAGGAGATTTAACACATGGAATAATAAACAGAGGAAGGCGGGCTAATGCAGAGCAGATGGGCCTGCAGGGCAGTGCTCAGCATTTCAACATCTTTCCCCTGGACCTTTGGACCCAAGGTGATTGCATGCTGGTGTCTTTAGCTAAAAATAAAGTTAATGTCTTTGGGGCAATCATAAATATGGCTGCTTCAGTTTCTGGGGTGATTGGTGGTCTAAAGTTTTCAAGAACCTACTATGTGAAAGGCATTTGA Translation Sequence: MKTMATRKRC KLSRTGPEFE NVIKRLLCAR TFHTRIGGDL THGIINRGRR ANAEQMGLQG SAQHFNIFPL DLWTQGDCML VSLAKNKVNV FGAIINMAAS VSGVIGGLKF SRTYYVKGI Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.