ARF6 encodes a member of the human ARF gene family, which is part of the RAS superfamily. The ARF genes encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. The product of this gene is localized to the plasma membrane, and regulates vesicular trafficking, remodelling of membrane lipids, and signaling pathways that lead to actin remodeling. A pseudogene of this gene is located on chromosome 7. Vector Description: This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 528bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGGGAAGGTGCTATCCAAAATCTTCGGGAACAAGGAAATGCGGATCCTCATGTTGGGCCTGGACGCGGCCGGCAAGACAACAATCCTGTACAAGTTGAAGCTGGGCCAGTCGGTGACCACCATTCCCACTGTGGGTTTCAACGTGGAGACGGTGACTTACAAAAATGTCAAGTTCAACGTATGGGATGTGGGCGGCCAGGACAAGATCCGGCCGCTCTGGCGGCATTACTACACTGGGACCCAAGGTCTCATCTTCGTAGTGGACTGCGCCGACCGCGACCGCATCGATGAGGCTCGCCAGGAGCTGCACCGCATTATCAATGACCGGGAGATGAGGGACGCCATAATCCTCATCTTCGCCAACAAGCAGGACCTGCCCGATGCCATGAAACCCCACGAGATCCAGGAGAAACTGGGCCTGACCCGGATTCGGGACAGGAACTGGTATGTGCAGCCCTCCTGTGCCACCTCAGGGGACGGACTCTATGAGGGGCTCACATGGTTAACCTCTAACTACAAATCTTAA Translation Sequence: MGKVLSKIFG NKEMRILMLG LDAAGKTTIL YKLKLGQSVT TIPTVGFNVE TVTYKNVKFN VWDVGGQDKI RPLWRHYYTG TQGLIFVVDC ADRDRIDEAR QELHRIINDR EMRDAIILIF ANKQDLPDAM KPHEIQEKLG LTRIRDRNWY VQPSCATSGD GLYEGLTWLT SNYKS Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
