ATP5H cDNA

Artikelnummer: USB-551847
Artikelname: ATP5H cDNA
Artikelnummer: USB-551847
Hersteller Artikelnummer: 551847
Alternativnummer: USB-551847-10
Hersteller: US Biological
Kategorie: Molekularbiologie
ATP5H belongs to the ATPase d subunit family. ATP5H exists as two alternatively spliced isoforms and is encoded by a gene that maps to human chromosome 17q25. 1 Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 486bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCTGGGCGAAAACTTGCTCTAAAAACCATTGACTGGGTAGCTTTTGCAGAGATCATACCCCAGAACCAAAAGGCCATTGCTAGTTCCCTGAAATCCTGGAATGAGACCCTCACCTCCAGGTTGGCTGCTTTACCTGAGAATCCACCAGCTATCGACTGGGCTTACTACAAGGCCAATGTGGCCAAGGCTGGCTTGGTGGATGACTTTGAGAAGAAGTTTAATGCGCTGAAGGTTCCCGTGCCAGAGGATAAATATACTGCCCAGGTGGATGCCGAAGAAAAAGAAGATGTGAAATCTTGTGCTGAGTGGGTGTCTCTCTCAAAGGCCAGGATTGTAGAATATGAGAAAGAGATGGAGAAGATGAAGAACTTAATTCCATTTGATCAGATGACCATTGAGGACTTGAATGAAGCTTTCCCAGAAACCAAATTAGACAAGAAAAAGTATCCCTATTGGCCTCACCAACCAATTGAGAATTTATAA Translation Sequence: MAGRKLALKT IDWVAFAEII PQNQKAIASS LKSWNETLTS RLAALPENPP AIDWAYYKAN VAKAGLVDDF EKKFNALKVP VPEDKYTAQV DAEEKEDVKS CAEWVSLSKA RIVEYEKEME KMKNLIPFDQ MTIEDLNEAF PETKLDKKKY PYWPHQPIEN L Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 006347
Formulierung: Supplied as a lyophilized powder.