BCL7A is directly involved, with Myc and IgH, in a three-way gene translocation in a Burkitt lymphoma cell line. As a result of the gene translocation, the N-terminal region of the gene product is disrupted, which is thought to be related to the pathogenesis of a subset of high-grade B cell non-Hodgkin lymphoma. The N-terminal segment involved in the translocation includes the region that shares a strong sequence similarity with those of BCL7B and BCL7C. Two transcript variants encoding different isoforms have been found for this gene. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 633bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGTCGGGCAGGTCGGTTCGAGCCGAGACGAGGAGCCGGGCCAAAGATGATATCAAGAGGGTCATGGCGGCGATCGAGAAAGTGCGCAAATGGGAGAAGAAATGGGTGACCGTTGGTGACACATCCCTACGAATCTACAAATGGGTCCCTGTGACGGAGCCCAAGGTTGATGACAAAAACAAGAATAAGAAAAAAGGCAAGGACGAGAAGTGTGGCTCAGAGGTGACCACTCCGGAGAACAGTTCCTCCCCAGGGATGATGGACATGCATGACGATAACAGCAACCAGAGCTCCATCGCAGATGCCTCCCCCATCAAACAGGAGAACAGCAGCAACTCCAGCCCCGCTCCAGAGCCCAACTCGGCTGTGCCCAGCGACGGCACCGAGGCCAAGGTGGATGAGGCCCAGGCTGATGGGAAGGAGCACCCAGGAGCTGAAGATGCTTCTGATGAGCAGAATTCACAGTCCTCGATGGAACATTCGATGAACAGCTCAGAGAAAGTAGATCGGCAGCCGTCTGGAGACTCGGGTCTGGCCGCAGAGACGTCTGCAATCTCTCAGGATCTGGAAGGAGTGCCACCCTCTAAAAAGATGAAACTGGAGGCCTCTCAACAAAACTCCGAAGAGATGTAG Translation Sequence: MSGRSVRAET RSRAKDDIKR VMAAIEKVRK WEKKWVTVGD TSLRIYKWVP VTEPKVDDKN KNKKKGKDEK CGSEVTTPEN SSSPGMMDMH DDNSNQSSIA DASPIKQENS SNSSPAPEPN SAVPSDGTEA KVDEAQADGK EHPGAEDASD EQNSQSSMEH SMNSSEKVDR QPSGDSGLAA ETSAISQDLE GVPPSKKMKL EASQQNSEEM Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
