BUD31 (BUD31 Homolog (S. Cerevisiae) ) is a nuclear protein that belongs to the BuD31 (G10) family. It contains a putative nuclear translocation sequence, an N-terminal acidic domain and a cysteine-rich C-terminal domain containing a putative Zinc-finger structure. The structure of BuD31 suggests that it may be a nuclear regulator of transcription. Vector Description: This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 435bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGCCTAAAGTCAAAAGAAGCCGGAAAGCACCCCCAGATGGCTGGGAGTTGATTGAGCCAACACTGGATGAATTAGATCAAAAGATGAGAGAAGCTGAAACAGAACCGCATGAGGGAAAGAGGAAAGTGGAATCTCTGTGGCCCATCTTCAGGATCCACCACCAGAAAACCCGCTACATCTTCGACCTCTTTTACAAGCGGAAAGCCATCAGCAGAGAACTCTATGAATATTGTATTAAAGAAGGCTATGCAGACAAAAACCTGATTGCAAAATGGAAAAAGCAAGGATATGAGAACTTGTGCTGCCTGCGGTGCATTCAGACACGGGACACCAACTTCGGGACGAACTGCATCTGCCGCGTGCCCAAAAGCAAGCTGGAAGTGGGCCGCATCATCGAGTGCACACACTGTGGCTGTCGTGGCTGCTCTGGCTGA Translation Sequence: MPKVKRSRKA PPDGWELIEP TLDELDQKMR EAETEPHEGK RKVESLWPIF RIHHQKTRYI FDLFYKRKAI SRELYEYCIK EGYADKNLIA KWKKQGYENL CCLRCIQTRD TNFGTNCICR VPKSKLEVGR IIECTHCGCR GCSG Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.