CAPS encodes a calcium-binding protein, which may play a role in the regulation of ion transport. A similar protein was first described as a potentially important regulatory protein in the dog thyroid and was termed as R2D5 antigen in rabbit. Alternative splicing of this gene generates two transcript variants. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 570bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGCAGTGCCACAGGGATCTGGCTCTGTCCCAGGCCCTGTGGGGCTGGCAGTTGAGTAAGCAGTCAGGCTGGGCGCACCCATCCCTCCCCCACTCCCCACTGCCCAGCACAGTGCATTCATGCAGCTGGGCCCCACCCCATCTCCAGAGGCACCTTCCACTAGCAACAGTCTCCCCAGGCACAACACAGCTAACACAAGGCCCCGCAGGCAGGACTCTGGGACAGACGCAGGCCAGCTGCCCAGAGCCCAGACCAAGCATGGACGCCGTGGATGCCACCATGGAGAAACTCCGGGCACAGTGCCTGTCCCGCGGGGCCTCGGGCATCCAGGGCCTGGCCAGGTTTTTCCGCCAACTAGACCGGGACGGGAGCAGATCCCTGGACGCTGATGAGTTCCGGCAGGGTCTGGCCAAACTCGGGCTGGTGCTGGACCAGGCGGAGGCAGAGGGTGTGTGCAGGAAGTGGGACCGCAATGGCAGCGGGACGCTGGATCTGGAGGAGTTCCTTCGGGCGCTGCGGCCCCCCATGTCCCAGGCCCGGGAGGCTGTCATCGCAGCTGCATTTGCCAAGCTGGACCGCAGTGGGGACGGCGTCGTGACGGTGGACGACCTCCGCGGGGTGTACAGTGGCCGTGCCCACCCCAAGGTGCGCAGTGGGGAGTGGACCGAGGACGAGGTGCTGCGCCGCTTCCTGGACAACTTCGACTCCTCTGAGAAGGACGGGCAGGTCACACTGGCGGAATTCCAGGACTACTACAGCGGCGTGAGTGCCTCCATGAACACGGATGAGGAGTTCGTGGCCATGATGACCAGTGCCTGGCAGCTGTGA Translation Sequence: MQCHRDLALS QALWGWQLSK QSGWAHPSLP HSPLPSTVHS CSWAPPHLQR HLPLATVSPG TTQLTQGPAG RTLGQTQASC PEPRPSMDAV DATMEKLRAQ CLSRGASGIQ GLARFFRQLD RDGSRSLDAD EFRQGLAKLG LVLDQAEAEG VCRKWDRNGS GTLDLEEFLR ALRPPMSQAR EAVIAAAFAK LDRSGDGVVT VDDLRGVYSG RAHPKVRSGE WTEDEVLRRF LDNFDSSEKD GQVTLAEFQD YYSGVSASMN TDEEFVAMMT SAWQL Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.