CAV2 belongs to the caveolin family and may act as a scaffolding protein within caveolar membranes. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. Additional isoforms resulting from the use of alternate in-frame translation initiation codons have also been described, and shown to have preferential localization in the cell. Vector Description: This shuttle vector contains the complete ORF. It is inseted Nde I to Hind III. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 489bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGGGCTGGAGACGGAGAAGGCGGACGTACAGCTCTTCATGGACGACGACTCCTACAGCCACCACAGCGGCCTCGAGTACGCCGACCCCGAGAAGTTCGCGGACTCGGACCAGGACCGGGATCCCCACCGGCTCAACTCGCATCTCAAGCTGGGCTTCGAGGATGTGATCGCAGAGCCGGTGACTACGCACTCCTTTGACAAAGTGTGGATCTGCAGCCATGCCCTCTTTGAAATCAGCAAATACGTAATGTACAAGTTCCTGACGGTGTTCCTGGCCATTCCCCTGGCCTTCATTGCGGGAATTCTCTTTGCCACCCTCAGCTGTCTGCACATCTGGATTTTAATGCCTTTTGTAAAGACCTGCCTAATGGTTCTGCCTTCAGTGCAGACAATATGGAAGAGTGTGACAGATGTTATCATTGCTCCATTGTGTACGAGCGTAGGACGATGCTTCTCTTCTGTCAGCCTGCAACTGAGCCAGGATTGA Translation Sequence: MGLETEKADV QLFMDDDSYS HHSGLEYADP EKFADSDQDR DPHRLNSHLK LGFEDVIAEP VTTHSFDKVW ICSHALFEIS KYVMYKFLTV FLAIPLAFIA GILFATLSCL HIWILMPFVK TCLMVLPSVQ TIWKSVTDVI IAPLCTSVGR CFSSVSLQLS QD Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.