CETN1 plays important roles in the determination of centrosome position and segregation, and in the process of microtubule severing. This protein is localized to the centrosome of interphase cells, and redistributes to the region of the spindle poles during mitosis, reflecting the dynamic behavior of the centrosome during the cell cycle. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 519bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCTTCCGGCTTCAAGAAGCCCAGCGCTGCCTCCACCGGCCAAAAGAGAAAGGTGGCACCTAAGCCCGAGCTCACTGAGGATCAGAAGCAAGAAGTTCGGGAAGCATTTGACCTCTTCGACGTGGACGGAAGTGGGACCATCGACGCGAAGGAGCTGAAGGTGGCCATGAGAGCGCTGGGCTTCGAACCCAGGAAGGAAGAGATGAAGAAAATGATCTCCGAGGTGGACAGGGAAGGCACGGGGAAGATCAGCTTCAATGACTTCCTGGCCGTGATGACGCAGAAGATGTCCGAGAAGGACACCAAAGAAGAAATCCTGAAGGCCTTCAGGCTCTTTGATGACGATGAGACCGGGAAGATCTCGTTCAAAAACCTGAAGCGTGTGGCCAACGAGCTGGGGGAGAACCTCACGGATGAGGAGCTGCAGGAGATGATCGACGAAGCTGATCGGGATGGGGACGGCGAAGTGAACGAGGAGGAGTTCCTTCGGATCATGAAGAAGACCAGCCTTTACTGA Translation Sequence: MASGFKKPSA ASTGQKRKVA PKPELTEDQK QEVREAFDLF DVDGSGTIDA KELKVAMRAL GFEPRKEEMK KMISEVDREG TGKISFNDFL AVMTQKMSEK DTKEEILKAF RLFDDDETGK ISFKNLKRVA NELGENLTDE ELQEMIDEAD RDGDGEVNEE EFLRIMKKTS LY Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.