CETN2 cDNA

Artikelnummer: USB-551879
Artikelname: CETN2 cDNA
Artikelnummer: USB-551879
Hersteller Artikelnummer: 551879
Alternativnummer: USB-551879-10
Hersteller: US Biological
Kategorie: Molekularbiologie
Caltractin belongs to a family of calcium-binding proteins and is a structural component of the centrosome. The high level of conservation from algae to humans and its association with the centrosome suggested that caltractin plays a fundamental role in the structure and function of the microtubule-organizing center, possibly required for the proper duplication and segregation of the centrosome. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 519bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCCTCCAACTTTAAGAAGGCAAACATGGCATCAAGTTCTCAGCGAAAAAGAATGAGCCCTAAGCCTGAGCTTACTGAAGAGCAAAAGCAGGAGATCCGGGAAGCTTTTGATCTTTTCGATGCGGATGGAACTGGCACCATAGATGTTAAAGAACTGAAGGTGGCAATGAGGGCCCTGGGCTTTGAACCCAAGAAAGAAGAAATTAAGAAAATGATAAGTGAAATTGATAAGGAAGGGACAGGAAAAATGAACTTTGGTGACTTTTTAACTGTGATGACCCAGAAAATGTCTGAGAAAGATACTAAAGAAGAAATCCTGAAAGCTTTCAAGCTCTTTGATGATGATGAAACTGGGAAGATTTCGTTCAAAAATCTGAAACGCGTGGCCAAGGAGTTGGGTGAGAACCTGACTGATGAGGAGCTGCAGGAAATGATTGATGAAGCTGATCGAGATGGAGATGGAGAGGTCAGTGAGCAAGAGTTCCTGCGCATCATGAAAAAGACCAGCCTCTATTAA Translation Sequence: MASNFKKANM ASSSQRKRMS PKPELTEEQK QEIREAFDLF DADGTGTIDV KELKVAMRAL GFEPKKEEIK KMISEIDKEG TGKMNFGDFL TVMTQKMSEK DTKEEILKAF KLFDDDETGK ISFKNLKRVA KELGENLTDE ELQEMIDEAD RDGDGEVSEQ EFLRIMKKTS LY Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 004335
Formulierung: Supplied as a lyophilized powder.