CHRAC1 is a histone-fold protein that interacts with other histone-fold proteins to bind DNA in a sequence-independent manner. It forms a complex with DNA polymerase epsilon subunit POLE3 and binds naked DNA, which is then incorporated into chromatin, aided by the nucleosome remodeling activity of ISWI/SNF2H and ACF1. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 396bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCGGACGTGGTCGTGGGTAAAGACAAGGGCGGGGAGCAGCGGCTCATCTCGCTGCCTCTATCCCGCATCCGGGTCATCATGAAGAGCTCCCCCGAGGTGTCCAGCATCAACCAGGAGGCGTTGGTGCTCACGGCCAAGGCCACGGAGCTCTTTGTTCAATGCCTAGCCACCTATTCCTACAGACACGGCAGTGGAAAGGAAAAGAAAGTACTGACTTACAGTGATTTAGCAAACACTGCACAGCAATCAGAAACTTTTCAGTTTCTTGCAGATATATTACCAAAGAAGATTTTAGCTAGTAAATACCTGAAAATGCTTAAAGAGGAAAAGAGGGAAGAAGATGAGGAGAATGACAATGATAATGAAAGTGACCATGATGAAGCTGACTCCTAA Translation Sequence: MADVVVGKDK GGEQRLISLP LSRIRVIMKS SPEVSSINQE ALVLTAKATE LFVQCLATYS YRHGSGKEKK VLTYSDLANT AQQSETFQFL ADILPKKILA SKYLKMLKEE KREEDEENDN DNESDHDEAD S Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
