CHTF8 cDNA

Artikelnummer: USB-551885
Artikelname: CHTF8 cDNA
Artikelnummer: USB-551885
Hersteller Artikelnummer: 551885
Alternativnummer: USB-551885-10
Hersteller: US Biological
Kategorie: Molekularbiologie
CTF8 is a member of the DERPC family and is encoded by a gene that maps to human chromosome 16q22. 1. It exists as two alternatively spliced isoforms. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 366bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGTGCAAATTGTTATTTCCAGTGCGAGGGCTGGAGGCCTGGCAGAATGGGTGCTGATGGAGCTACAGGGGGAGATCGAGGCTCGCTACAGCACTGGATTAGCTGGAAACCTCCTGGGAGACCTACATTACACCACTGAGGGAATCCCTGTGCTGATCGTGGGGCATCATATCCTGTATGGGAAAATCATCCACCTGGAGAAACCTTTTGCAGTCCTTGTCAAACACACTCCTGGGGATCAGGACTGTGATGAGCTTGGCCGCGAGACTGGCACCCGGTACCTGGTGACAGCACTCATCAAAGACAAGATCCTTTTCAAAACCCGCCCCAAGCCCATTATCACCAGCGTCCCCAAGAAAGTATGA Translation Sequence: MVQIVISSAR AGGLAEWVLM ELQGEIEARY STGLAGNLLG DLHYTTEGIP VLIVGHHILYGKIIHLEKPF AVLVKHTPGD QDCDELGRET GTRYLVTALI KDKILFKTRP KPIITSVPKKV Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 001035236
Formulierung: Supplied as a lyophilized powder.