Inhibition of the nuclear export of poly (A) -containing mRNAs caused by the influenza A virus NS1 protein requires its effector domain. The NS1 effector domain functionally interacts with the cellular 30kD subunit of cleavage and polyadenylation specific factor 4, an essential component of the 3 end processing machinery of cellular pre-mRNAs. In influenza virus-infected cells, the NS1 protein is physically associated with cleavage and polyadenylation specific factor 4, 30kD subunit. Binding of the NS1 protein to the 30kD protein in vitro prevents CPSF binding to the RNA substrate and inhibits 3 end cleavage and polyadenylation of host pre-mRNAs. Thus the NS1 protein selectively inhibits the nuclear export of cellular, and not viral, mRNAs. Multiple alternatively spliced transcript variants that encode different isoforms have been described for CPSF4. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 735bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGCAGGAAATCATCGCCAGCGTGGACCACATCAAGTTTGACTTGGAGATCGCGGTGGAGCAGCAGCTGGGGGCGCAGCCGCTGCCCTTCCCCGGCATGGACAAGTCGGGCGCTGCTGTCTGTGAATTCTTTTTGAAAGCTGCCTGCGGCAAAGGGGGCATGTGTCCGTTTCGCCACATCAGTGGTGAGAAGACAGTTGTGTGCAAACACTGGCTGCGTGGCCTATGCAAGAAAGGGGACCAGTGTGAGTTCCTGCATGAGTATGACATGACCAAGATGCCCGAGTGCTACTTCTACTCCAAGTTCGGGGAGTGCAGCAACAAGGAATGTCCCTTCCTGCACATCGACCCCGAGTCCAAGATCAAGGACTGTCCTTGGTATGACCGTGGCTTCTGCAAGCACGGTCCCCTCTGCAGGCACCGGCACACACGGAGAGTCATCTGTGTGAATTACCTCGTGGGATTCTGCCCGGAGGGGCCCTCGTGTAAATTCATGCACCCTCGATTTGAACTGCCCATGGGAACCACCGAGCAGCCCCCACTGCCGCAGCAGACACAGCCTCCAGCAAAGCAGAGAACCCCGCAGGTCATCGGGGTCATGCAGAGTCAAAACAGCAGCGCGGGCAACCGGGGACCCCGGCCACTGGAGCAGGTCACCTGTTACAAGTGTGGCGAGAAAGGACACTACGCCAACAGATGCACCAAAGGGCACTTGGCCTTTCTCAGTGGACAGTGA Translation Sequence: MQEIIASVDH IKFDLEIAVE QQLGAQPLPF PGMDKSGAAV CEFFLKAACG KGGMCPFRHISGEKTVVCKH WLRGLCKKGD QCEFLHEYDM TKMPECYFYS KFGECSNKEC PFLHIDPESKIKDCPWYDRG FCKHGPLCRH RHTRRVICVN YLVGFCPEGP SCKFMHPRFE LPMGTTEQPPLPQQTQPPAK QRTPQVIGVM QSQNSSAGNR GPRPLEQVTC YKCGEKGHYA NRCTKGHLAFLSGQ Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
