CYCS encodes a small heme protein that functions as a central component of the electron transport chain in mitochondria. The encoded protein associates with the inner membrane of the mitochondrion where it accepts electrons from cytochrome b and transfers them to the cytochrome oxidase complex. This protein is also involved in initiation of apoptosis. Mutations in this gene are associated with autosomal dominant nonsyndromic thrombocytopenia. Numerous processed pseudogenes of this gene are found throughout the human genome. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 318bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGGTGATGTTGAGAAAGGCAAGAAGATTTTTATTATGAAGTGTTCCCAGTGCCACACCGTTGAAAAGGGAGGCAAGCACAAGACTGGGCCAAATCTCCATGGTCTCTTTGGGCGGAAGACAGGTCAGGCCCCTGGATACTCTTACACAGCCGCCAATAAGAACAAAGGCATCATCTGGGGAGAGGATACACTGATGGAGTATTTGGAGAATCCCAAGAAGTACATCCCTGGAACAAAAATGATCTTTGTCGGCATTAAGAAGAAGGAAGAAAGGGCAGACTTAATAGCTTATCTCAAAAAAGCTACTAATGAGTAA Translation Sequence: MGDVEKGKKI FIMKCSQCHT VEKGGKHKTG PNLHGLFGRK TGQAPGYSYT AANKNKGIIW GEDTLMEYLE NPKKYIPGTK MIFVGIKKKE ERADLIAYLK KATNE Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.