D-dopachrome tautomerase converts D-dopachrome into 5, 6-dihydroxyindole. The DDT gene is related to the migration inhibitory factor (MIF) in terms of sequence, enzyme activity, and gene structure. DDT and MIF are closely linked on chromosome 22. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 357bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGCCGTTCCTGGAGCTGGACACGAATTTGCCCGCCAACCGAGTGCCCGCGGGGCTGGAGAAACGACTCTGCGCCGCCGCTGCCTCCATCCTGGGCAAACCTGCGGACCGCGTGAACGTGACGGTACGGCCGGGCCTGGCCATGGCGCTGAGCGGGTCCACCGAGCCCTGCGCGCAGCTGTCCATCTCCTCCATCGGCGTAGTGGGCACCGCCGAGGACAACCGCAGCCACAGCGCCCACTTCTTTGAGTTTCTCACCAAGGAGCTAGCCCTGGGCCAGGACCGGATACTTATCCGCTTTTTCCCCTTGGAGTCCTGGCAGATTGGCAAGATAGGGACGGTCATGACTTTTTTATGA Translation Sequence: MPFLELDTNL PANRVPAGLE KRLCAAAASI LGKPADRVNV TVRPGLAMAL SGSTEPCAQL SISSIGVVGT AEDNRSHSAH FFEFLTKELA LGQDRILIRF FPLESWQIGK IGTVMTFL Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.