DNAJC24 cDNA

Artikelnummer: USB-551923
Artikelname: DNAJC24 cDNA
Artikelnummer: USB-551923
Hersteller Artikelnummer: 551923
Alternativnummer: USB-551923-10
Hersteller: US Biological
Kategorie: Molekularbiologie
DnaJ homolog subfamily C member 24, also known as DNAJC24, is a member of the ZCSL family of proteins and each contain one DPH-type zinc finger. This enzyme is involved in the synthesis of diphthamide, a protein found on translation elongation factor EF-2 that is the target of bacterial ADP-ribosylating toxins. DNAJC24 stimulates the ATPase activity of several Hsp70-type chaperones. It is detected in heart, brain, spleen, lung, liver, kidney and testis. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 450bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGATGGCGGTTGAGCAGATGCCAAAAAAGGATTGGTACAGCATCCTGGGAGCAGACCCATCTGCAAATATATCAGACCTAAAACAAAAATATCAAAAACTCATATTAATGTATCATCCAGATAAACAAAGTACAGATGTACCAGCAGGAACAGTGGAGGAATGTGTACAGAAGTTCATCGAAATTGATCAAGCATGGAAAATTCTAGGAAATGAAGAGACAAAAAGAGAGTATGACCTGCAGCGGTGTGAAGATGATCTAAGAAATGTAGGACCAGTAGATGCTCAAGTATATCTTGAAGAAATGTCTTGGAATGAAGGTGATCACTCTTTTTATCTGAGTTGCAGATGTGGTGGAAAATACAGTGTTTCCAAGGATGAAGCGGAAGAAGTTAGCCTGATTTCTTGTGATACATGTTCACTAATTATAGAACTCCTTCATTATAACTAA Translation Sequence: MMAVEQMPKK DWYSILGADP SANISDLKQK YQKLILMYHP DKQSTDVPAG TVEECVQKFIEIDQAWKILG NEETKREYDL QRCEDDLRNV GPVDAQVYLE EMSWNEGDHS FYLSCRCGGKYSVSKDEAEE VSLISCDTCS LIIELLHYN Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 859057
Formulierung: Supplied as a lyophilized powder.