DPPA3 cDNA

Artikelnummer: USB-551929
Artikelname: DPPA3 cDNA
Artikelnummer: USB-551929
Hersteller Artikelnummer: 551929
Alternativnummer: USB-551929-10
Hersteller: US Biological
Kategorie: Molekularbiologie
DPPA3 encodes a protein that in mice may function as a maternal factor during the preimplantation stage of development. In mice, this gene may play a role in transcriptional repression, cell division, and maintenance of cell pluripotentiality. In humans, related intronless loci are located on chromosomes 14 and X. Vector Description: This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 480bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGACCCATCACAGTTTAATCCAACCTACATCCCAGGGTCTCCACAAATGCTCACCGAAGAAAATTCCCGGGACGATTCAGGGGCCTCTCAAATCTCCTCCGAGACGTTGATAAAGAACCTTAGTAACTTGACTATCAACGCTAGTAGCGAATCTGTTTCCCCTCTATCGGAAGCTTTACTCCGTCGAGAGTCTGTAGGAGCAGCAGTCCTCAGGGAAATCGAAGATGAGTGGCTTTACAGCAGGAGAGGAGTAAGAACATTGCTGTCTGTGCAGAGAGAAAAGATGGCAAGATTGAGATACATGTTACTCGGCGGAGTTCGTACGCATGAAAGAAGACCAACAAACAAGGAGCCTAAGGGAGTTAAGAAGGAATCAAGACCATTCAAATGTCCCTGCAGTTTCTGCGTGTCTAATGGATGGGATCCTTCTGAGAATGCTAGAATAGGGAATCAAGACACCAAGCCACTTCAGCCATAA Translation Sequence: MDPSQFNPTY IPGSPQMLTE ENSRDDSGAS QISSETLIKN LSNLTINASS ESVSPLSEAL LRRESVGAAV LREIEDEWLY SRRGVRTLLS VQREKMARLR YMLLGGVRTH ERRPTNKEPK GVKKESRPFK CPCSFCVSNG WDPSENARIG NQDTKPLQP Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 954980
Formulierung: Supplied as a lyophilized powder.