DUSP26 encodes a member of the tyrosine phosphatase family of proteins and exhibits dual specificity by dephosphorylating tyrosine as well as serine and threonine residues. This gene has been described as both a tumor suppressor and an oncogene depending on the cellular context. Alternative splicing results in multiple transcript variants. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Hind III. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 636bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGTGCCCTGGTAACTGGCTTTGGGCTTCTATGACTTTTATGGCCCGCTTCTCCCGGAGTAGCTCAAGGTCTCCTGTTCGAACTCGAGGGACCCTGGAGGAGATGCCAACCGTTCAACATCCTTTCCTCAATGTCTTCGAGTTGGAGCGGCTCCTCTACACAGGCAAGACAGCCTGTAACCATGCCGACGAGGTCTGGCCAGGCCTCTATCTCGGAGACCAGGACATGGCTAACAACCGCCGGGAGCTTCGCCGCCTGGGCATCACGCACGTCCTCAATGCCTCACACAGCCGGTGGCGAGGCACGCCCGAGGCCTATGAGGGGCTGGGCATCCGCTACCTGGGTGTTGAGGCCCACGACTCGCCAGCCTTTGACATGAGCATCCACTTCCAGACGGCTGCCGACTTCATCCACCGGGCGCTGAGCCAGCCAGGAGGGAAGATCCTGGTGCATTGTGCTGTGGGCGTGAGCCGATCCGCCACCCTGGTACTGGCCTACCTCATGCTGTACCACCACCTTACCCTCGTGGAGGCCATCAAGAAAGTCAAAGACCACCGAGGCATCATCCCCAACCGGGGCTTCCTGAGGCAGCTCCTGGCCCTGGACCGCAGGCTGCGGCAGGGTCTGGAAGCATGA Translation Sequence: MCPGNWLWAS MTFMARFSRS SSRSPVRTRG TLEEMPTVQH PFLNVFELER LLYTGKTACN HADEVWPGLY LGDQDMANNR RELRRLGITH VLNASHSRWR GTPEAYEGLG IRYLGVEAHD SPAFDMSIHF QTAADFIHRA LSQPGGKILV HCAVGVSRSA TLVLAYLMLY HHLTLVEAIK KVKDHRGIIP NRGFLRQLLA LDRRLRQGLE A Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.