EIF1AX cDNA

Artikelnummer: USB-551941
Artikelname: EIF1AX cDNA
Artikelnummer: USB-551941
Hersteller Artikelnummer: 551941
Alternativnummer: USB-551941-10
Hersteller: US Biological
Kategorie: Molekularbiologie
EIF1AX encodes an essential eukaryotic translation initiation factor. The protein is required for the binding of the 43S complex (a 40S subunit, eIF2/GTP/Met-tRNAi and eIF3) to the 5 end of capped RNA. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 435bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGCCCAAGAATAAAGGTAAAGGAGGTAAAAACAGACGCAGGGGTAAGAATGAGAATGAATCTGAAAAAAGAGAACTGGTATTCAAAGAGGATGGTCAGGAGTATGCTCAGGTAATCAAAATGTTGGGAAATGGACGGCTAGAAGCAATGTGTTTCGATGGTGTAAAGAGGTTATGTCACATCAGAGGAAAATTGAGAAAAAAGGTTTGGATAAATACCTCGGACATTATTTTGGTTGGTCTCCGAGACTACCAGGATAACAAAGCTGATGTAATTTTAAAATACAATGCAGACGAAGCTAGAAGTCTGAAGGCATACGGCGAGCTTCCAGAGCATGCTAAAATCAATGAAACTGATACATTTGGTCCTGGAGATGATGATGAAATTCAGTTTGATGACATTGGAGATGATGATGAAGATATTGATGACATCTAA Translation Sequence: MPKNKGKGGK NRRRGKNENE SEKRELVFKE DGQEYAQVIK MLGNGRLEAM CFDGVKRLCH IRGKLRKKVW INTSDIILVG LRDYQDNKAD VILKYNADEA RSLKAYGELP EHAKINETDT FGPGDDDEIQ FDDIGDDDED IDDI Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 001403
Formulierung: Supplied as a lyophilized powder.