GABARAPL1 cDNA

Artikelnummer: USB-551963
Artikelname: GABARAPL1 cDNA
Artikelnummer: USB-551963
Hersteller Artikelnummer: 551963
Alternativnummer: USB-551963-10
Hersteller: US Biological
Kategorie: Molekularbiologie
GABARAPL1 (GABA (A) Receptor-Associated Protein Like 1) is a Protein Coding gene. Diseases associated with GABARAPL1 include spastic hemiplegia. Among its related pathways are FoxO signaling pathway and Circadian entrainment. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 354bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGAAGTTCCAGTACAAGGAGGACCATCCCTTTGAGTATCGGAAAAAGGAAGGAGAAAAGATCCGGAAGAAATATCCGGACAGGGTCCCCGTGATTGTAGAGAAGGCTCCAAAAGCCAGGGTGCCTGATCTGGACAAGAGGAAGTACCTAGTGCCCTCTGACCTTACTGTTGGCCAGTTCTACTTCTTAATCCGGAAGAGAATCCACCTGAGACCTGAGGACGCCTTATTCTTCTTTGTCAACAACACCATCCCTCCCACCAGTGCTACCATGGGCCAACTGTATGAGGACAATCATGAGGAAGACTATTTTCTGTATGTGGCCTACAGTGATGAGAGTGTCTATGGGAAATGA Translation Sequence: MKFQYKEDHP FEYRKKEGEK IRKKYPDRVP VIVEKAPKAR VPDLDKRKYL VPSDLTVGQF YFLIRKRIHL RPEDALFFFV NNTIPPTSAT MGQLYEDNHE EDYFLYVAYS DESVYGK Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 113600
Formulierung: Supplied as a lyophilized powder.