GCA product, grancalcin, is a calcium-binding protein abundant in neutrophils and macrophages. It belongs to the penta-EF-hand subfamily of proteins which includes sorcin, calpain, and ALG-2. Grancalcin localization is dependent upon calcium and magnesium. In the absence of divalent cation, grancalcin localizes to the cytosolic fraction, with magnesium alone, it partitions with the granule fraction, and in the presence of magnesium and calcium, it associates with both the granule and membrane fractions, suggesting a role for grancalcin in granule-membrane fusion and degranulation. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 654bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCCTACCCGGGATACGGAGGAGGGTTTGGAAATTTTAGCATTCAGGTGCCAGGAATGCAGATGGGACAGCCAGTGCCAGAAACAGGCCCAGCTATACTCCTCGATGGATACTCTGGGCCAGCATATTCAGACACTTATTCCTCAGCTGGTGACTCCGTGTATACTTACTTCAGTGCTGTTGCTGGACAGGATGGTGAAGTGGATGCTGAAGAACTTCAGAGATGTTTGACACAGTCTGGAATTAATGGAACTTACTCTCCCTTCAGTTTGGAAACCTGCAGAATTATGATTGCCATGTTGGATAGAGATCACACAGGAAAAATGGGATTTAATGCATTCAAAGAGCTATGGGCAGCTCTTAATGCCTGGAAGGAAAACTTCATGACTGTTGATCAAGATGGAAGTGGCACAGTAGAACATCATGAGTTGCGTCAAGCCATTGGTCTTATGGGTTATAGGTTGAGTCCTCAAACATTAACTACTATTGTTAAACGTTATAGCAAGAATGGCAGAATTTTCTTTGATGATTATGTTGCTTGCTGTGTGAAGCTTCGAGCATTGACAGATTTCTTTAGGAAAAGAGACCACTTGCAACAAGGGTCTGCGAATTTCATATATGACGATTTTTTGCAGGGCACTATGGCAATTTGA Translation Sequence: MAYPGYGGGF GNFSIQVPGM QMGQPVPETG PAILLDGYSG PAYSDTYSSA GDSVYTYFSA VAGQDGEVDA EELQRCLTQS GINGTYSPFS LETCRIMIAM LDRDHTGKMG FNAFKELWAA LNAWKENFMT VDQDGSGTVE HHELRQAIGL MGYRLSPQTL TTIVKRYSKN GRIFFDDYVA CCVKLRALTD FFRKRDHLQQ GSANFIYDDF LQGTMAI Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
