GEMIN7 cDNA

Artikelnummer: USB-551972
Artikelname: GEMIN7 cDNA
Artikelnummer: USB-551972
Hersteller Artikelnummer: 551972
Alternativnummer: USB-551972-10
Hersteller: US Biological
Kategorie: Molekularbiologie
GEMIN7 encoded by this gene is a component of the core SMN complex, which is required for pre-mRNA splicing in the nucleus. The encoded protein is found in the nucleoplasm, in nuclear gems (Gemini of Cajal bodies), and in the cytoplasm. Three transcript variants encoding the same protein have been found for this gene. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 396bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGCAAACTCCAGTGAACATTCCCGTGCCTGTGCTCCGGCTGCCCCGGGGCCCTGATGGCTTCAGCCGTGGCTTTGCCCCTGATGGACGCAGAGCCCCCTTGAGGCCAGAGGTTCCTGAAATCCAGGAGTGTCCCATAGCTCAAGAATCCCTGGAATCCCAGGAGCAGCGGGCACGAGCCGCCCTTCGGGAGCGTTACCTCCGCAGCCTGCTGGCCATGGTGGGTCATCAGGTGAGCTTCACGTTGCACGAGGGTGTGCGTGTGGCCGCCCACTTTGGAGCCACCGACCTGGATGTGGCCAACTTCTACGTGTCACAGCTGCAGACTCCCATAGGTGTGCAAGCAGAGGCGCTGCTCCGATGTAGTGACATTATTTCATATACCTTCAAGCCATAA Translation Sequence: MQTPVNIPVP VLRLPRGPDG FSRGFAPDGR RAPLRPEVPE IQECPIAQES LESQEQRARA ALRERYLRSL LAMVGHQVSF TLHEGVRVAA HFGATDLDVA NFYVSQLQTP IGVQAEALLR CSDIISYTFK P Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 078983
Formulierung: Supplied as a lyophilized powder.