H3F3A cDNA

Artikelnummer: USB-551989
Artikelname: H3F3A cDNA
Artikelnummer: USB-551989
Hersteller Artikelnummer: 551989
Alternativnummer: USB-551989-10
Hersteller: US Biological
Kategorie: Molekularbiologie
H3F3A is a variant histone H3 which replaces conventional H3 in a wide range of nucleosomes in active genes. It constitutes the predominant form of histone H3 in non-dividing cells and is incorporated into chromatin independently of DNA synthesis. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 411bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCTCGTACAAAGCAGACTGCCCGCAAATCGACCGGTGGTAAAGCACCCAGGAAGCAACTGGCTACAAAAGCCGCTCGCAAGAGTGCGCCCTCTACTGGAGGGGTGAAGAAACCTCATCGTTACAGGCCTGGTACTGTGGCGCTCCGTGAAATTAGACGTTATCAGAAGTCCACTGAACTTCTGATTCGCAAACTTCCCTTCCAGCGTCTGGTGCGAGAAATTGCTCAGGACTTTAAAACAGATCTGCGCTTCCAGAGCGCAGCTATCGGTGCTTTGCAGGAGGCAAGTGAGGCCTATCTGGTTGGCCTTTTTGAAGACACCAACCTGTGTGCTATCCATGCCAAACGTGTAACAATTATGCCAAAAGACATCCAGCTAGCACGCCGCATACGTGGAGAACGTGCTTAA Translation Sequence: MARTKQTARK STGGKAPRKQ LATKAARKSA PSTGGVKKPH RYRPGTVALR EIRRYQKSTE LLIRKLPFQR LVREIAQDFK TDLRFQSAAI GALQEASEAY LVGLFEDTNL CAIHAKRVTI MPKDIQLARR IRGERA Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 002098
Formulierung: Supplied as a lyophilized powder.