LAMTOR2 cDNA

Artikelnummer: USB-552051
Artikelname: LAMTOR2 cDNA
Artikelnummer: USB-552051
Hersteller Artikelnummer: 552051
Alternativnummer: USB-552051-10
Hersteller: US Biological
Kategorie: Molekularbiologie
The product of ROBLD3 is highly conserved with a mouse protein associated with the cytoplasmic face of late endosomes and lysosomes. The mouse protein interacts with MAPK scaffold protein 1, a component of the mitogen-activated protein kinase pathway. In humans, a mutation in this gene has been associated with a primary immunodeficiency syndrome, and suggests a role for this protein in endosomal biogenesis. Multiple transcript variants encoding different isoforms have been found for this gene. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 378bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGCTGCGCCCCAAGGCTTTGACCCAGGTGCTAAGCCAAGCCAACACTGGAGGCGTCCAGAGCACCCTGCTGCTGAATAACGAGGGATCACTGCTGGCCTACTCTGGTTACGGGGACACTGACGCCCGGGTCACCGCTGCCATAGCCAGTAACATCTGGGCCGCCTACGACCGGAACGGGAACCAAGCGTTTAATGAAGACAATCTCAAATTCATCCTCATGGACTGCATGGAGGGCCGTGTAGCCATCACCCGAGTGGCCAACCTTCTGCTGTGTATGTATGCCAAGGAGACCGTGGGCTTTGGAATGCTCAAGGCCAAGGCCCAGGCTTTGGTGCAGTACCTGGAGGAGCCCCTCACCCAAGTGGCGGCATCTTAA Translation Sequence: MLRPKALTQV LSQANTGGVQ STLLLNNEGS LLAYSGYGDT DARVTAAIAS NIWAAYDRNG NQAFNEDNLK FILMDCMEGR VAITRVANLL LCMYAKETVG FGMLKAKAQA LVQYLEEPLT QVAAS Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 054736
Formulierung: Supplied as a lyophilized powder.