MAPKSP1 encodes a scaffold protein that functions in the extracellular signal-regulated kinase (ERK) cascade. The protein is localized to late endosomes by the mitogen-activated protein-binding protein-interacting protein, and binds specifically to MAP kinase kinase MAP2K1/MEK1, MAP kinase MAPK3/ERK1, and MAP kinase MAPK1/ERK2. Studies of the orthologous gene in mouse indicate that it regulates late endosomal traffic and cell proliferation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. A pseudogene of this gene is located on the long arm of chromosome 13. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 375bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCGGATGACCTAAAGCGATTCTTGTATAAAAAGTTACCAAGTGTTGAAGGGCTCCATGCCATTGTTGTGTCAGATAGAGATGGAGTACCTGTTATTAAAGTGGCAAATGACAATGCTCCAGAGCATGCTTTGCGACCTGGTTTCTTATCCACTTTTGCCCTTGCAACAGACCAAGGAAGCAAACTTGGACTTTCCAAAAATAAAAGTATCATCTGTTACTATAACACCTACCAGGTGGTTCAATTTAATCGTTTACCTTTGGTGGTGAGTTTCATAGCCAGCAGCAGTGCCAATACAGGACTAATTGTCAGCCTAGAAAAGGAACTTGCTCCATTGTTTGAAGAACTGAGACAAGTTGTGGAAGTTTCTTAA Translation Sequence: MADDLKRFLY KKLPSVEGLH AIVVSDRDGV PVIKVANDNA PEHALRPGFL STFALATDQG SKLGLSKNKS IICYYNTYQV VQFNRLPLVV SFIASSSANT GLIVSLEKEL APLFEELRQV VEVS Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
