LGALS13 cDNA

Artikelnummer: USB-552055
Artikelname: LGALS13 cDNA
Artikelnummer: USB-552055
Hersteller Artikelnummer: 552055
Alternativnummer: USB-552055-10
Hersteller: US Biological
Kategorie: Molekularbiologie
LGALS13 has lysophospholipase activity that act on biological membranes to regulate the multifunctional lysophospholipids. It is composed of two identical subunits which are held together by disulfide bonds. LGALS13 has structural similarity to several members of the beta-galactoside-binding S-type lectin family. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 420bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGTCTTCTTTACCCGTGCCATACAAACTGCCTGTGTCTTTGTCTGTTGGTTCCTGCGTGATAATCAAAGGGACACCAATCCACTCTTTTATCAATGACCCACAGCTGCAGGTGGATTTCTACACTGACATGGATGAGGATTCAGATATTGCCTTCCGTTTCCGAGTGCACTTTGGCAATCATGTGGTCATGAACAGGCGTGAGTTTGGGATATGGATGTTGGAGGAGACAACAGACTACGTGCCCTTTGAGGATGGCAAACAATTTGAGCTGTGCATCTACGTACATTACAATGAGTATGAGATAAAGGTCAATGGCATACGCATTTACGGCTTTGTCCATCGAATCCCGCCATCATTTGTGAAGATGGTGCAAGTGTCGAGAGATATCTCCCTGACCTCAGTGTGTGTCTGCAATTGA Translation Sequence: MSSLPVPYKL PVSLSVGSCV IIKGTPIHSF INDPQLQVDF YTDMDEDSDI AFRFRVHFGNHVVMNRREFG IWMLEETTDY VPFEDGKQFE LCIYVHYNEY EIKVNGIRIY GFVHRIPPSFVKMVQVSRDI SLTSVCVCN Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 037400
Formulierung: Supplied as a lyophilized powder.