LGALS7 cDNA

Artikelnummer: USB-552056
Artikelname: LGALS7 cDNA
Artikelnummer: USB-552056
Hersteller Artikelnummer: 552056
Alternativnummer: USB-552056-10
Hersteller: US Biological
Kategorie: Molekularbiologie
LGALS7 (galectin7) is a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. Members of this family have been implicated in a variety of functions, including growth regulation, cell adhesion, migration, neoplastic transformation, and immune responses. It is expressed mainly in stratified squamous epithelium, LGALS7 protein is activated by p53 and repressed by retinoic acid. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 411bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGTCTGCTACCCAGCACAAGACCTCCCTGCCTCAGGGCGTCCGCGTGGGCACTGTCATGAGAATTCGAGGCATGGTCCCTGACCAGGCTGGCAGGTTCCATGTAAACCTGCTATGCGGTGAGGAGCAAGGAGCAGATGCCGCCTTGCACTTTAACCCGAGGCTGGACACTTCCGAGGTTGTCTTCAACACCAAAGAACAAGGCAAATGGGGCCGTGAGGAGCGAGGCACCGGCATCCCCTTCGAGCGTGGGCAGCCCTTTGAAGTGCTCCTCATCGCCACAGAGGAAGGCTTCAAGGCTGTGGTCGGGGATGACGAATATCTCCACTTCCACCACCGGATGCCGCCCGCGCGCGTGCGCTTGGTGGAGGTGGGCGGAGACGTGCAGCTGCATTCAGTGAAGATCTTCTAA Translation Sequence: MSATQHKTSL PQGVRVGTVM RIRGMVPDQA GRFHVNLLCG EEQGADAALH FNPRLDTSEVVFNTKEQGKW GREERGTGIP FERGQPFEVL LIATEEGFKA VVGDDEYLHF HHRMPPARVRLVEVGGDVQL HSVKIF Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 032522
Formulierung: Supplied as a lyophilized powder.