MARCKSL1 encodes a member of the myristoylated alanine-rich C-kinase substrate (MARCKS) family. Members of this family play a role in cytoskeletal regulation, protein kinase C signaling and calmodulin signaling. The encoded protein affects the formation of adherens junction. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene are located on the long arm of chromosomes 6 and 10. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 588bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGGCAGCCAGAGCTCCAAGGCTCCCCGGGGCGACGTGACCGCCGAGGAGGCAGCAGGCGCTTCCCCCGCGAAGGCCAACGGCCAGGAGAATGGCCACGTGAAAAGCAATGGAGACTTATCCCCCAAGGGTGAAGGGGAGTCGCCCCCTGTGAACGGAACAGATGAGGCAGCCGGGGCCACTGGCGATGCCATCGAGCCAGCACCCCCTAGCCAGGGTGCTGAGGCCAAGGGGGAGGTCCCCCCCAAGGAGACCCCCAAGAAGAAGAAGAAATTCTCTTTCAAGAAGCCTTTCAAATTGAGCGGCCTGTCCTTCAAGAGAAATCGGAAGGAGGGTGGGGGTGATTCTTCTGCCTCCTCACCCACAGAGGAAGAGCAGGAGCAGGGGGAGATCGGTGCCTGCAGCGACGAGGGCACTGCTCAGGAAGGGAAGGCCGCAGCCACCCCTGAGAGCCAGGAACCCCAGGCCAAGGGGGCAGAGGCTAGTGCAGCCTCAGAAGAAGAGGCAGGGCCCCAGGCTACAGAGCCATCCACTCCCTCGGGGCCGGAGAGTGGCCCTACACCAGCCAGCGCTGAGCAGAATGAGTAG Translation Sequence: MGSQSSKAPR GDVTAEEAAG ASPAKANGQE NGHVKSNGDL SPKGEGESPP VNGTDEAAGA TGDAIEPAPP SQGAEAKGEV PPKETPKKKK KFSFKKPFKL SGLSFKRNRK EGGGDSSASS PTEEEQEQGE IGACSDEGTA QEGKAAATPE SQEPQAKGAE ASAASEEEAG PQATEPSTPS GPESGPTPAS AEQNE Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.