MBD3 cDNA

Artikelnummer: USB-552073
Artikelname: MBD3 cDNA
Artikelnummer: USB-552073
Hersteller Artikelnummer: 552073
Alternativnummer: USB-552073-10
Hersteller: US Biological
Kategorie: Molekularbiologie
DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. This gene belongs to a family of nuclear proteins which are characterized by the presence of a methyl-CpG binding domain (MBD). The encoded protein is a subunit of the NuRD, a multisubunit complex containing nucleosome remodeling and histone deacetylase activities. Unlike the other family members, the encoded protein is not capable of binding to methylated DNA. The protein mediates the association of metastasis-associated protein 2 with the core histone deacetylase complex. Alternative splicing results in multiple transcript variants of this gene. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 876bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGAGCGGAAGAGGTGGGAGTGCCCGGCGCTCCCGCAGGGCTGGGAGAGGGAAGAAGTGCCCAGAAGGTCGGGGCTGTCGGCCGGCCACAGGGATGTCTTTTACTATAGCCCGAGCGGGAAGAAGTTCCGCAGCAAGCCGCAGCTGGCGCGCTACCTGGGCGGCTCCATGGACCTGAGCACCTTCGACTTCCGCACGGGCAAGATGCTGATGAGCAAGATGAACAAGAGCCGCCAGCGCGTGCGCTACGACTCCTCCAACCAGGTCAAGGGCAAGCCCGACCTGAACACGGCGCTGCCCGTGCGCCAGACGGCGTCCATCTTCAAGCAGCCGGTGACCAAGATTACCAACCACCCCAGCAACAAGGTCAAGAGCGACCCGCAGAAGGCGGTGGACCAGCCGCGCCAGCTCTTCTGGGAGAAGAAGCTGAGCGGCCTGAACGCCTTCGACATTGCTGAGGAGCTGGTCAAGACCATGGACCTCCCCAAGGGCCTGCAGGGGGTGGGACCTGGCTGCACGGATGAGACGCTGCTGTCGGCCATCGCCAGCGCCCTGCACACTAGCACCATGCCCATCACGGGACAGCTCTCGGCCGCCGTGGAGAAGAACCCCGGCGTATGGCTCAACACCACGCAGCCCCTGTGCAAAGCCTTCATGGTGACCGACGAGGACATCAGGAAGCAGGAAGAGCTGGTGCAGCAGGTGCGGAAGCGGCTGGAGGAGGCGCTGATGGCCGACATGCTGGCGCACGTGGAGGAGCTGGCCCGTGACGGGGAGGCGCCGCTGGACAAGGCCTGCGCTGAGGACGACGACGAGGAAGACGAGGAGGAGGAGGAGGAGGAGCCCGACCCGGACCCGGAGATGGAGCACGTCTAG Translation Sequence: MERKRWECPA LPQGWEREEV PRRSGLSAGH RDVFYYSPSG KKFRSKPQLA RYLGGSMDLS TFDFRTGKML MSKMNKSRQR VRYDSSNQVK GKPDLNTALP VRQTASIFKQ PVTKITNHPS NKVKSDPQKA VDQPRQLFWE KKLSGLNAFD IAEELVKTMD LPKGLQGVGP GCTDETLLSA IASALHTSTM PITGQLSAAV EKNPGVWLNT TQPLCKAFMV TDEDIRKQEE LVQQVRKRLE EALMADMLAH VEELARDGEA PLDKACAEDD DEEDEEEEEE EPDPDPEMEH V Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 003917
Formulierung: Supplied as a lyophilized powder.