MED21 cDNA

Artikelnummer: USB-552082
Artikelname: MED21 cDNA
Artikelnummer: USB-552082
Hersteller Artikelnummer: 552082
Alternativnummer: USB-552082-10
Hersteller: US Biological
Kategorie: Molekularbiologie
MED21 is a member of the mediator complex subunit 21 family. The encoded protein interacts with the human RNA polymerase II holoenzyme and is involved in transcriptional regulation of RNA polymerase II transcribed genes. A pseudogene of this gene is located on chromosome 8. Alternative splicing results in multiple transcript variants. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 435bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCGGATCGGCTCACGCAGCTTCAGGACGCTGTGAATTCGCTTGCAGATCAGTTTTGTAATGCCATTGGAGTATTGCAGCAATGTGGTCCTCCTGCCTCTTTCAATAATATTCAGACAGCAATTAACAAAGACCAGCCAGCTAACCCTACAGAAGAGTATGCCCAGCTTTTTGCAGCACTGATTGCACGAACAGCAAAAGACATTGATGTTTTGATAGATTCCTTACCCAGTGAAGAATCTACAGCTGCTTTACAGGCTGCTAGCTTGTATAAGCTAGAAGAAGAAAACCATGAAGCTGCTACATGTCTGGAGGATGTTGTTTATCGAGGAGACATGCTTCTGGAGAAGATACAAAGCGCACTTGCTGATATTGCACAGTCACAGCTGAAGACAAGAAGTGGTACCCATAGCCAGTCTCTTCCAGACTCATAG Translation Sequence: MADRLTQLQD AVNSLADQFC NAIGVLQQCG PPASFNNIQT AINKDQPANP TEEYAQLFAALIARTAKDID VLIDSLPSEE STAALQAASL YKLEEENHEA ATCLEDVVYR GDMLLEKIQSALADIAQSQL KTRSGTHSQS LPDS Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 004255
Formulierung: Supplied as a lyophilized powder.