MIS12 is a component of the MIS12 complex, which is required for kinetochore formation during mitosis and normal chromosome alignment and segregation. The MIS12 complex consists of MIS12, DSN1, NSL1 and PMF-1. MIS12 is part of a network of complexes that provide microtubule attachment and generates pulling forces from depolymerization. Vector Description: This shuttle vector contains the complete ORF. It is inseted Nde I to Hind III. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 618bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGTCTGTGGATCCAATGACCTACGAGGCCCAGTTCTTTGGCTTCACGCCACAAACGTGCATGCTTCGGATCTACATTGCATTTCAAGACTACCTATTTGAAGTGATGCAGGCCGTTGAACAGGTTATTCTGAAGAAGCTGGATGGCATCCCAGACTGTGACATTAGCCCAGTGCAGATTCGCAAATGCACAGAGAAGTTTCTTTGCTTCATGAAAGGACATTTTGATAACCTTTTTAGCAAAATGGAGCAACTGTTTTTGCAGCTGATTTTACGTATTCCCTCAAACATCTTGCTTCCTGAAGATAAATGTAAGGAGACACCTTATAGTGAGGAAGATTTTCAGCATCTCCAGAAAGAAATTGAACAGTTACAGGAGAAGTACAAGACTGAATTATGTACTAAGCAGGCCCTTCTTGCAGAATTAGAAGAGCAAAAAATTGTTCAGGCCAAACTCAAACAGACGTTGACTTTCTTTGATGAGCTTCATAATGTTGGCAGAGATCATGGGACTAGTGATTTTAGGGAGAGTTTAGTATCCCTGGTTCAGAACTCCAGAAAACTACAGAACATTAGAGACAATGTGGAAAAGGAATCGAAACGACTGAAAATATCTTAA Translation Sequence: MSVDPMTYEA QFFGFTPQTC MLRIYIAFQD YLFEVMQAVE QVILKKLDGI PDCDISPVQI RKCTEKFLCF MKGHFDNLFS KMEQLFLQLI LRIPSNILLP EDKCKETPYS EEDFQHLQKE IEQLQEKYKT ELCTKQALLA ELEEQKIVQA KLKQTLTFFD ELHNVGRDHG TSDFRESLVS LVQNSRKLQN IRDNVEKESK RLKIS Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
