MRI (modulator of retrovirus infection homolog) characterizes the hamster ortholog and suggests that it may modulate the ability of the proteasome to degrade retroviral cores upon cellular infection. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 474bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGAAACCTTACAATCCGAGACTAAAACGAGGGTCCTTCCCTCATGGCTGACAGCCCAGGTGGCTACAAAGAATGTGGCACCAATGAAGGCCCCCAAGAGGATGAGAATGGCAGCAGTGCCAGTGGCAGCAGCAAGACTCCCTGCGACAAGGACTGTGTACTGCATGAATGAGGCTGAGATAGTTGATGTTGCTCTGGGAATCCTGATTGAGAGCCGCAAACAGGAAAAGGCCTGCGAGCAGCCGGCCCTGGCGGGGGCTGATAACCCAGAGCACTCCCCTCCCTGCTCCGTGTCGCCTCACACAAGTTCTGGGAGCAGCAGTGAGGAAGAGGACAGTGGGAAACAGGCACTGGCTCCAGGCCTCAGCCCTTCCCAGAGGCCGGGGGGTTCCAGCTCTGCCTGTAGCAGGAGCCCTGAGGAGGAGGAGGAAGAGGATGTGCTGAAATACGTCCGGGAGATCTTTTTCAGCTAG Translation Sequence: METLQSETKT RVLPSWLTAQ VATKNVAPMK APKRMRMAAV PVAAARLPAT RTVYCMNEAE IVDVALGILI ESRKQEKACE QPALAGADNP EHSPPCSVSP HTSSGSSSEE EDSGKQALAP GLSPSQRPGG SSSACSRSPE EEEEEDVLKY VREIFFS Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
