MTHFS an enzyme that catalyzes the conversion of 5-formyltetrahydrofolate to 5, 10-methenyltetrahydrofolate, a precursor of reduced folates involved in 1-carbon metabolism. An increased activity of the encoded protein can result in an increased folate turnover rate and folate depletion. Three transcript variants encoding two different isoforms have been found for MTHFS. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 612bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCGGCGGCAGCGGTGAGCAGCGCCAAGCGGAGCCTGCGGGGAGAGCTGAAGCAGCGTCTGCGGGCGATGAGTGCCGAGGAGCGGCTACGCCAGTCCCGCGTACTGAGCCAGAAGGTGATTGCCCACAGTGAGTATCAAAAGTCCAAAAGAATTTCCATCTTTCTGAGCATGCAAGATGAAATTGAGACAGAAGAGATCATCAAGGACATTTTCCAACGAGGCAAAATCTGCTTCATCCCTCGGTACCGGTTCCAGAGCAATCACATGGATATGGTGAGAATAGAATCACCAGAGGAAATTTCTTTACTTCCCAAAACATCCTGGAATATCCCTCAGCCTGGTGAGGGTGATGTTCGGGAGGAGGCCTTGTCCACAGGGGGACTTGATCTCATCTTCATGCCAGGCCTTGGGTTTGACAAACATGGCAACCGACTGGGGAGGGGCAAGGGCTACTATGATGCCTATCTGAAGCGCTGTTTGCAGCATCAGGAAGTGAAGCCCTACACCCTGGCGTTGGCTTTCAAAGAACAGATTTGCCTCCAGGTCCCAGTGAATGAAAACGACATGAAGGTAGATGAAGTCCTTTACGAAGACTCGTCAACAGCTTAA Translation Sequence: MAAAAVSSAK RSLRGELKQR LRAMSAEERL RQSRVLSQKV IAHSEYQKSK RISIFLSMQDEIETEEIIKD IFQRGKICFI PRYRFQSNHM DMVRIESPEE ISLLPKTSWN IPQPGEGDVREEALSTGGLD LIFMPGLGFD KHGNRLGRGK GYYDAYLKRC LQHQEVKPYT LALAFKEQICLQVPVNENDM KVDEVLYEDS STA Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
