NDUFA8 belongs to the complex I 19kD subunit family. Mammalian complex I is composed of 45 different subunits. This has NADH dehydrogenase activity and oxidoreductase activity. It plays an important role in transfering electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. Vector Description: This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 519bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGCCGGGGATAGTGGAGCTGCCCACTCTAGAGGAGCTGAAAGTAGATGAGGTGAAAATTAGTTCTGCTGTGCTTAAAGCTGCGGCCCATCACTATGGAGCTCAATGTGATAAGCCCAACAAGGAGTTTATGCTCTGCCGCTGGGAAGAGAAAGATCCGAGGCGGTGTTTAGAGGAAGGCAAACTGGTCAACAAGTGTGCTTTGGACTTCTTTAGGCAGATAAAACGTCACTGTGCAGAGCCTTTTACAGAATATTGGACTTGCATTGATTATACTGGCCAGCAGTTATTTCGTCACTGTCGCAAACAGCAGGCAAAGTTTGACGAGTGTGTGCTGGACAAACTGGGCTGGGTGCGGCCTGACCTGGGAGAACTGTCAAAGGTCACCAAAGTGAAAACAGATCGACCTTTACCGGAGAATCCCTATCACTCAAGACCAAGACCGGATCCCAGCCCTGAGATCGAGGGAGATCTGCAGCCTGCCACACATGGCAGCCGCTTTTATTTCTGGACCAAGTAA Translation Sequence: MPGIVELPTL EELKVDEVKI SSAVLKAAAH HYGAQCDKPN KEFMLCRWEE KDPRRCLEEG KLVNKCALDF FRQIKRHCAE PFTEYWTCID YTGQQLFRHC RKQQAKFDEC VLDKLGWVRP DLGELSKVTK VKTDRPLPEN PYHSRPRPDP SPEIEGDLQP ATHGSRFYFW TK Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
