NPM3 is related to the nuclear chaperone phosphoproteins, nucleoplasmin and nucleophosmin. NPM3 is strongly expressed in diverse cell types where it localizes primarily to the nucleus. Based on its similarity to nucleoplasmin and nucleophosmin, NPM3 likely functions as a molecular chaperone in the cell nucleus. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 537bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCCGCCGGTACTGCAGCTGCCTTAGCGTTTTTGAGTCAGGAGAGCCGAACGCGGGCCGGGGGTGTCGGGGGCCTACGGGTCCCGGCCCCGGTCACTATGGACAGTTTTTTCTTCGGCTGTGAGCTCTCCGGCCACACCCGCTCCTTCACCTTTAAGGTAGAGGAAGAGGATGATGCGGAGCACGTGCTGGCACTAACCATGCTCTGCCTCACCGAGGGAGCCAAAGACGAGTGTAATGTGGTAGAAGTTGTGGCCCGGAACCATGACCATCAGGAGATCGCAGTCCCTGTGGCCAACCTCAAGCTGTCCTGCCAACCCATGCTCAGTCTGGATGACTTCCAGCTCCAACCACCTGTAACCTTCCGCCTGAAGTCGGGCTCTGGCCCTGTGCGGATCACTGGGCGGCACCAGATTGTTACGATGAGCAATGATGTTTCTGAGGAGGAGAGCGAGGAAGAGGAAGAGGACAGTGATGAGGAAGAAGTTGAGCTGTGCCCCATCCTTCCTGCCAAAAAGCAGGGGGGCAGGCCCTAG Translation Sequence: MAAGTAAALA FLSQESRTRA GGVGGLRVPA PVTMDSFFFG CELSGHTRSF TFKVEEEDDAEHVLALTMLC LTEGAKDECN VVEVVARNHD HQEIAVPVAN LKLSCQPMLS LDDFQLQPPVTFRLKSGSGP VRITGRHQIV TMSNDVSEEE SEEEEEDSDE EEVELCPILP AKKQGGRP Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.