NUDT4 regulates the turnover of diphosphoinositol polyphosphates. The turnover of these high-energy diphosphoinositol polyphosphates represents a molecular switching activity with important regulatory consequences. Molecular switching by diphosphoinositol polyphosphates may contribute to regulating intracellular trafficking. Several alternatively spliced transcript variants have been described, but the full-length nature of some variants has not been determined. Isoforms DIPP2alpha and DIPP2beta are distinguishable from each other solely by DIPP2beta possessing one additional amino acid due to intron boundary skidding in alternate splicing. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 543bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGATGAAGTTCAAGCCCAACCAGACGCGGACCTACGACCGCGAGGGCTTCAAGAAGCGGGCGGCGTGCCTGTGCTTCCGGAGCGAGCAGGAGGACGAGGTGCTGCTGGTGAGTAGCAGCCGGTACCCAGACCAGTGGATTGTCCCAGGAGGAGGAATGGAACCCGAGGAGGAACCTGGCGGTGCTGCCGTGAGGGAAGTTTATGAGGAGGCTGGAGTCAAAGGAAAACTAGGCAGACTTCTGGGCATATTTGAGAACCAAGACCGAAAGCACAGAACATATGTTTATGTTCTAACAGTCACTGAAATATTAGAAGATTGGGAAGATTCTGTTAATATTGGAAGGAAGAGAGAGTGGTTCAAAGTAGAAGATGCTATCAAAGTTCTCCAGTGTCATAAACCTGTACATGCAGAGTATCTGGAAAAGCTAAAGCTGGGTTGTTCCCCAGCCAATGGAAATTCTACAGTCCCTTCCCTTCCGGATAATAATGCCTTGTTTGTAACCGCTGCACAGACCTCTGGGTTGCCATCTAGTGTAAGATAG Translation Sequence: MMKFKPNQTR TYDREGFKKR AACLCFRSEQ EDEVLLVSSS RYPDQWIVPG GGMEPEEEPGGAAVREVYEE AGVKGKLGRL LGIFENQDRK HRTYVYVLTV TEILEDWEDS VNIGRKREWFKVEDAIKVLQ CHKPVHAEYL EKLKLGCSPA NGNSTVPSLP DNNALFVTAA QTSGLPSSVR Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
