OPA3 plays some role in mitochondrial processes. Mutations in OPA3 have been shown to result in 3-methylglutaconic aciduria type III and autosomal dominant optic atrophy and cataract. Multiple transcript variants encoding different isoforms have been found for OPA3. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Hind III. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 543bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGTGGTGGGCGCGTTCCCTATGGCGAAGCTGCTATACTTGGGCATCCGGCAGGTCAGCAAGCCGCTTGCCAACCGTATTAAGGAGGCCGCCCGCCGAAGCGAGTTCTTCAAGACCTATATCTGCCTCCCGCCGGCTCAACTGTACCACTGGCTGGAGATGCGGACCAAAATGCGCATCATGGGTTTCAATGCCGCTGCCATCAAGCCGCTGAACGAGGGTGCAGCCGCCGAGCTGGGCGCGGAGCTGCTGGGCGAGGGCATCATCTTCATCACCGCCTGCAGCTGCCTGATGCTGGAGTATTGGCGCCACCAGTTGCAGCAGCGCCGCAAGGAAAAGGAGCGACGTGTTGCCAGGGAGGCGCTGCGGGGCGAGGTGGGCCACTTGGGGCTGGCGCTCGAGGAGTTGCAGGCGCAGGTGCAGGCGACGTCGACGCAGCTCGCCCTGGAGGAGCTGCGCGCTCAGCTGCAGGAGGTGCGAGCCCACCTCTGCCTCCGAGACCCGCCGCCTGCACCCCCAGTTGCGCCGGCGTCCGAGAAATAG Translation Sequence: MVVGAFPMAK LLYLGIRQVS KPLANRIKEA ARRSEFFKTY ICLPPAQLYH WLEMRTKMRIMGFNAAAIKP LNEGAAAELG AELLGEGIIF ITACSCLMLE YWRHQLQQRR KEKERRVAREALRGEVGHLG LALEELQAQV QATSTQLALE ELRAQLQEVR AHLCLRDPPP APPVAPASEK Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.