PMVK cDNA

Artikelnummer: USB-552178
Artikelname: PMVK cDNA
Artikelnummer: USB-552178
Hersteller Artikelnummer: 552178
Alternativnummer: USB-552178-10
Hersteller: US Biological
Kategorie: Molekularbiologie
PMVK encodes a peroxisomal enzyme that catalyzes the conversion of mevalonate 5-phosphate into mevalonate 5-diphosphate, the fifth reaction of the cholesterol biosynthetic pathway. Studies in rat show that the message level and the enzyme activity of this protein is regulated by sterol, and that this regulation is coordinated with 3-hydroxy-3-methylglutaryl coenzyme A reductase, the rate-limiting enzyme of cholesterol biosynthesis. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 579bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCCCCGCTGGGAGGCGCCCCGCGGCTGGTACTGCTGTTCAGCGGCAAGAGGAAATCCGGGAAGGACTTCGTGACCGAGGCGCTGCAGAGCAGACTTGGAGCTGATGTCTGTGCTGTCCTCCGGCTCTCTGGTCCACTCAAGGAACAGTATGCTCAGGAGCATGGCTTGAACTTCCAGAGACTCCTGGACACCAGCACCTACAAGGAGGCCTTTCGGAAGGACATGATCCGCTGGGGAGAGGAGAAACGCCAGGCTGACCCAGGCTTCTTTTGCAGGAAGATTGTGGAGGGCATCTCCCAGCCCATCTGGCTGGTGAGTGACACACGGAGAGTGTCTGACATCCAGTGGTTTCGGGAGGCCTATGGGGCCGTGACGCAGACGGTCCGCGTTGTAGCGTTGGAGCAGAGCCGACAGCAGCGGGGCTGGGTGTTCACGCCAGGGGTGGACGATGCTGAGTCAGAATGTGGCCTGGACAACTTCGGGGACTTTGACTGGGTCATCGAGAACCATGGAGTTGAACAGCGCCTGGAGGAGCAGTTGGAGAACCTGATAGAATTTATCCGCTCCAGACTTTAG Translation Sequence: MAPLGGAPRL VLLFSGKRKS GKDFVTEALQ SRLGADVCAV LRLSGPLKEQ YAQEHGLNFQ RLLDTSTYKE AFRKDMIRWG EEKRQADPGF FCRKIVEGIS QPIWLVSDTR RVSDIQWFRE AYGAVTQTVR VVALEQSRQQ RGWVFTPGVD DAESECGLDN FGDFDWVIEN HGVEQRLEEQ LENLIEFIRS RL Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 006547
Formulierung: Supplied as a lyophilized powder.