POLR2D cDNA

Artikelnummer: USB-552182
Artikelname: POLR2D cDNA
Artikelnummer: USB-552182
Hersteller Artikelnummer: 552182
Alternativnummer: USB-552182-10
Hersteller: US Biological
Kategorie: Molekularbiologie
POLR2D encodes the fourth largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. In yeast, this polymerase subunit is associated with the polymerase under suboptimal growth conditions and may have a stress protective role. A sequence for a ribosomal pseudogene is contained within the 3 untranslated region of the transcript from POLR2D. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 429bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCGGCGGGTGGCAGCGATCCGCGGGCTGGCGACGTAGAGGAGGACGCCTCACAGCTCATCTTTCCTAAAGAGTTTGAAACAGCTGAGACACTTCTAAATTCAGAAGTTCATATGCTTCTGGAACATCGAAAGCAGCAGAATGAGAGTGCAGAGGACGAACAGGAGCTCTCAGAAGTCTTCATGAAAACATTAAACTACACAGCCCGTTTCAGTCGTTTCAAAAACAGAGAGACCATTGCCAGTGTTCGTAGCTTGCTACTCCAGAAAAAGCTTCATAAGTTTGAGTTGGCCTGTTTGGCCAACCTTTGCCCAGAGACTGCTGAGGAGTCCAAGGCTCTAATCCCAAGCTTGGAGGGACGGTTTGAAGATGAGGAGCTGCAGCAGATTCTTGATGATATCCAGACAAAGCGCAGCTTTCAGTATTAA Translation Sequence: MAAGGSDPRA GDVEEDASQL IFPKEFETAE TLLNSEVHML LEHRKQQNES AEDEQELSEVFMKTLNYTAR FSRFKNRETI ASVRSLLLQK KLHKFELACL ANLCPETAEE SKALIPSLEGRFEDEELQQI LDDIQTKRSF QY Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 004796
Formulierung: Supplied as a lyophilized powder.