PPP3R2 cDNA

Artikelnummer: USB-552194
Artikelname: PPP3R2 cDNA
Artikelnummer: USB-552194
Hersteller Artikelnummer: 552194
Alternativnummer: USB-552194-10
Hersteller: US Biological
Kategorie: Molekularbiologie
PPP3R2 (Protein Phosphatase 3, Regulatory Subunit B, Beta) is a Protein Coding gene. Among its related pathways are MAPK signaling pathway and GPCR Pathway. GO annotations related to this gene include calcium ion binding. An important paralog of this gene is CHP1. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 522bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGTCCACAATGGGAAACGAGGCCAGTTACCCGGCGGAGATGTGCTCCCACTTTGACAATGATGAAATTAAAAGGCTGGGCAGGAGGTTTAAGAAGTTGGACTTGGACAAATCAGGGTCTCTGAGCGTGGAGGAGTTCATGTCCCTGCCGGAGCTGCGCCACAACCCGTTGGTGCGGCGAGTGATCGACGTCTTCGACACCGACGGTGATGGAGAAGTGGACTTCAAGGAATTCATCCTGGGGACCTCCCAGTTCAGCGTCAAGGGCGACGAGGAGCAGAAGTTGAGGTTTGCGTTCAGCATTTACGACATGGATAAAGATGGCTACATTTCCAACGGGGAGCTCTTCCAGGTGCTGAAGATGATGGTGGGCAACAACCTGACGGACTGGCAGCTCCAGCAGCTGGTCGACAAAACCATCATCATCCTGGACAAGGATGGCGATGGGAAGATATCCTTTGAGGAATTCAGTGCTGTGGTCAGAGACCTGGAGATCCACAAGAAGCTGGTCCTCATCGTATGA Translation Sequence: MSTMGNEASY PAEMCSHFDN DEIKRLGRRF KKLDLDKSGS LSVEEFMSLP ELRHNPLVRR VIDVFDTDGD GEVDFKEFIL GTSQFSVKGD EEQKLRFAFS IYDMDKDGYI SNGELFQVLK MMVGNNLTDW QLQQLVDKTI IILDKDGDGK ISFEEFSAVV RDLEIHKKLV LIV Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap
NCBI: 671709
Formulierung: Supplied as a lyophilized powder.