PSMB3 cDNA

Artikelnummer: USB-552198
Artikelname: PSMB3 cDNA
Artikelnummer: USB-552198
Hersteller Artikelnummer: 552198
Alternativnummer: USB-552198-10
Hersteller: US Biological
Kategorie: Molekularbiologie
The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits, 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. The 26 S proteasome may be involved in trinucleotide repeat expansion, a phenomenon which is associated with many hereditary neurological diseases. Pseudogenes have been identified on chromosomes 2 and 12. Alternative splicing results in multiple transcript variants. Vector Description: This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 618bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGTCTATTATGTCCTATAACGGAGGGGCCGTCATGGCCATGAAGGGGAAGAACTGTGTGGCCATCGCTGCAGACAGGCGCTTCGGGATCCAGGCCCAGATGGTGACCACGGACTTCCAGAAGATCTTTCCCATGGGTGACCGGCTGTACATCGGTCTGGCCGGGCTCGCCACTGACGTCCAGACAGTTGCCCAGCGCCTCAAGTTCCGGCTGAACCTGTATGAGTTGAAGGAAGGTCGGCAGATCAAACCTTATACCCTCATGAGCATGGTGGCCAACCTCTTGTATGAGAAACGGTTTGGCCCTTACTACACTGAGCCAGTCATTGCCGGGTTGGACCCGAAGACCTTTAAGCCCTTCATTTGCTCTCTAGACCTCATCGGCTGCCCCATGGTGACTGATGACTTTGTGGTCAGTGGCACCTGCGCCGAACAAATGTACGGAATGTGTGAGTCCCTCTGGGAGCCCAACATGGATCCGGATCACCTGTTTGAAACCATCTCCCAAGCCATGCTGAATGCTGTGGACCGGGATGCAGTGTCAGGCATGGGAGTCATTGTCCACATCATCGAGAAGGACAAAATCACCACCAGGACACTGAAGGCCCGAATGGACTAA Translation Sequence: MSIMSYNGGA VMAMKGKNCV AIAADRRFGI QAQMVTTDFQ KIFPMGDRLY IGLAGLATDV QTVAQRLKFR LNLYELKEGR QIKPYTLMSM VANLLYEKRF GPYYTEPVIA GLDPKTFKPF ICSLDLIGCP MVTDDFVVSG TCAEQMYGMC ESLWEPNMDP DHLFETISQA MLNAVDRDAV SGMGVIVHII EKDKITTRTL KARMD Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 002786
Formulierung: Supplied as a lyophilized powder.